Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCS1

Gene ID (NCBI) 23413
Gene Symbol NCS1
Protein Name neuronal calcium sensor 1
Synonyms FLUP|FREQ
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085874 IRAL014L10 pOTB7 BC004856 NM_014286 Full
HGY088806 IRAL022A06 pOTB7 BC008698 NM_014286

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE098408 M01C046A08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098456 M01C046C08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098504 M01C046E08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098552 M01C046G08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098600 M01C046I08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098648 M01C046K08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098696 M01C046M08 pDONR221 MGC12-F04 BC004856 ENST00000372398
HGE098744 M01C046O08 pDONR221 MGC12-F04 BC004856 ENST00000372398

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR162480 ARi06D08 pGCAP10 NM_014286.3
GAGCGCAGCGCGGGCGCCGCAGACAAAGGCGCGGCCCCGGCCCGGCCCGCCCGGCCCAGC
HKR325701 RBb14E05 pKA1U5 NM_014286.3
GGCCCAGTAACCAGGGTACGACCGCGGCCACACCCCGNCGGCGCCGGCGCCCAGCCCAGG
HKR399252 RBd98C04 pGCAP10 NM_014286.3
GAGGGGCGGCGGCAGGCGGGAGGCAGCAGCGAGCATGTGCCGCGGAGCCCAGTAACCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl