Prev. |  KEGG KO K19932 > 

RIKEN DNA Bank Human Resource - NCS1

Gene ID NCBI Gene 23413 |  KEGG hsa:23413
Gene Symbol NCS1
Protein Name neuronal calcium sensor 1
Synonyms FLUP|FREQ
Ortholog resource in our bank

  NCS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085874 IRAL014L10 pOTB7 BC004856 NM_014286 Full
HGY088806 IRAL022A06 pOTB7 BC008698 NM_014286

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098408 M01C046A08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098456 M01C046C08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098504 M01C046E08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098552 M01C046G08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098600 M01C046I08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098648 M01C046K08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098696 M01C046M08 pDONR221 MGC12-F04 BC004856 ENST00000372398  
HGE098744 M01C046O08 pDONR221 MGC12-F04 BC004856 ENST00000372398  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162480 ARi06D08 pGCAP10 NM_014286.3  
GAGCGCAGCGCGGGCGCCGCAGACAAAGGCGCGGCCCCGGCCCGGCCCGCCCGGCCCAGC
HKR325701 RBb14E05 pKA1U5 NM_014286.3  
GGCCCAGTAACCAGGGTACGACCGCGGCCACACCCCGNCGGCGCCGGCGCCCAGCCCAGG
HKR399252 RBd98C04 pGCAP10 NM_014286.3  
GAGGGGCGGCGGCAGGCGGGAGGCAGCAGCGAGCATGTGCCGCGGAGCCCAGTAACCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl