Prev. | 

RIKEN DNA Bank Human Resource - COMMD3

Gene ID NCBI Gene 23412 |  KEGG hsa:23412
Gene Symbol COMMD3
Protein Name COMM domain containing 3
Synonyms BUP|C10orf8
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084573 IRAL011H05 pOTB7 BC022898 NM_012071 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098002 M01C045A02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098050 M01C045C02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098098 M01C045E02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098146 M01C045G02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098194 M01C045I02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098242 M01C045K02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098290 M01C045M02 pDONR221 MGC12-B01 BC022898 NM_012071  
HGE098338 M01C045O02 pDONR221 MGC12-B01 BC022898 NM_012071  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051331 ARe28F11 pKA1U5 NM_012071.2  
GGGCGCGCTCACAATGGAGCTCTCGGAGTCTGTGCAGAAAGGCTTCCAGATGCTGGCGGA
HKR235097 ARiS087M09 pGCAP10 NM_012071.2  
GGTGCGTGTCGAAGGTCACGGCGCGCTCACAATGGAGCTCTCGGAGTCTGTGCAGAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl