Prev. |  KEGG KO K11411 > 

RIKEN DNA Bank Human Resource - SIRT1

Gene ID NCBI Gene 23411 |  KEGG hsa:23411
Gene Symbol SIRT1
Protein Name sirtuin 1
Synonyms SIR2|SIR2L1|SIR2alpha
Ortholog resource in our bank

  SIRT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363204 RBd08A04 pGCAP10 NM_012238.3 done
GAGTGCCGCGCGTCGAGCGGGAGCAGAGGAGGCGAGGGAGGAGGGCCAGAGAGGCAGTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl