Prev. | 

RIKEN DNA Bank Human Resource - COTL1

Gene ID NCBI Gene 23406 |  KEGG hsa:23406
Gene Symbol COTL1
Protein Name coactosin like F-actin binding protein 1
Synonyms CLP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030517 IRAK076E21 pBluescriptR BC042970 NM_021149 Full/var
HGX046034 IRAK115B10 pCMV-SPORT6 BC053682 NM_021149 Full
HGY083431 IRAL008J15 pOTB7 BC010884 NM_021149 Full
HGY090919 IRAL027E23 pOTB7 BC010039 NM_021149 Full
HGY093140 IRAL032O04 pDNR-LIB BC016702 NM_021149 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044850 ARe12C02 pKA1U5 NM_021149.2  
GGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGATAGCCGTCGCCACCGCCGCC
HKR044923 ARe12F03 pKA1U5 NM_021149.2  
GAGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCANGNNCCGCGNTAGCCGTTCGCCACCGC
HKR046402 ARe16A02 pKA1U5 NM_021149.2  
TGGCAGTGGAAGCCGCCGCCGCGCTCGCAGCCTCGCANGCGCCGCGTAGCCGTCGCCACC
HKR058525 ARe46F05 pKA1U5 NM_021149.2  
GAGGCGCCGCGNTAGCCGTCGCCACCGCCGCCAGCCCTTGCGCCCTCGGCGCGTACCCGC
HKR063745 ARe59G01 pKA1U5 NM_021149.2  
GGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGNTAGCCGTCGCCACCGCCG
HKR064011 ARe60A11 pKA1U5 NM_021149.2  
GAGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGNTAGCCGTCGCCACCGCC
HKR064128 ARe60F08 pKA1U5 NM_021149.2  
GGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGATAGCCGTCGCCACCGCCGCC
HKR067652 ARe69C04 pKA1U5 NM_021149.2  
AGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCNCCGCGTAGCCGTCGCCACCGCCGC
HKR162527 ARi06F07 pGCAP10 NM_021149.2  
GGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCGCCGCCA
HKR179706 ARi49E10 pGCAP10 NM_021149.2  
GAGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCGCCG
HKR186804 ARi67A04 pGCAP10 NM_021149.2  
GGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCGCCGCCA
HKR188153 ARi70G09 pGCAP10 NM_021149.2  
TGGGAGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCG
HKR205517 ARiS013N05 pGCAP10 NM_021149.2  
GGTGGANNNCGCCGCCNCNCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCGCCGC
HKR243762 ARiS109G18 pGCAP10 NM_021149.2  
GNNTGGAANCCGCCGCCNCGCTCGCAGCTCGCAGGNGCCGCGTAGCCGTCGCCACCNNCG
HKR248883 ARiS122D11 pGCAP10 NM_021149.2  
GAGTGGAANCCGCCGCCGCGCTCGCAGCTNNNAGGCGCCGCGTAGCCGTCNCCACCGCCG
HKR342001 RBb55A01 pGCAP1 NM_021149.2  
GGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGCCGTCGCCACCGCCGCCA
HKR380976 RBd52H08 pGCAP10 NM_021149.2  
CGGCCGGCCGATTTGAGTGGAAGCCGCCGCCGCGCTCGCAGCTCGCAGGCGCCGCGTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl