Prev. |  KEGG KO K17617 > 

RIKEN DNA Bank Human Resource - CTDNEP1

Gene ID NCBI Gene 23399 |  KEGG hsa:23399
Gene Symbol CTDNEP1
Protein Name CTD nuclear envelope phosphatase 1
Synonyms DULLARD|HSA011916|NET56
Ortholog resources KEGG ortholog (KEGG orthology K17617) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090503 IRAL026E07 pOTB7 BC009295 NM_015343

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044547 ARe11G03 pKA1U5 NM_015343.3  
GGGACGGTAAAATGGCGCCTGTCAGAGTGGGAAACCCAGCTGCAGAGGCTGCAGCCCCGG
HKR364003 RBd10A03 pGCAP10 NM_015343.3  
GGGAAAGACAGGAAGAGGGAGTCCTTTGGACGCCTCTCCTGCCACTCGGGGCCCCCGTTC
HKR370176 RBd25H08 pGCAP10 NM_015343.3  
GAGCGCGCCTGCGCAGCGGGCCACTCTCTGCTTTCCCCCCCTCCCCTTCCCTTTTCCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl