Prev. |  KEGG KO K12736 > 

RIKEN DNA Bank Human Resource - PPWD1

Gene ID NCBI Gene 23398 |  KEGG hsa:23398
Gene Symbol PPWD1
Protein Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms -
Ortholog resource in our bank

  PPWD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010810 IRAK027A10 pCMV-SPORT6 BC015385 NM_015342

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR185707 ARi64E11 pGCAP10 NM_015342.2  
HKR361649 RBd04C01 pGCAP10 NM_015342.2  
GGACGATGCGAACAACATGGCGGCGGAAAGTGGTAGCGATTTTCAGCAGAGACGTAGAAG
HKR444210 RBdS110I18 pGCAP10 NM_015342.2  
GGATGCGAACAACATGGCGGCGGAAAGTGGTAGCGATTTTCAGCAGAGACGTAGAAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl