Prev. |  KEGG KO K00889 > 

RIKEN DNA Bank Human Resource - PIP5K1C

Gene ID NCBI Gene 23396 |  KEGG hsa:23396
Gene Symbol PIP5K1C
Protein Name phosphatidylinositol-4-phosphate 5-kinase type 1 gamma
Synonyms LCCS3|PIP5K-GAMMA|PIP5K1-gamma|PIP5Kgamma
Ortholog resources KEGG ortholog (KEGG orthology K00889) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081139 IRAL002O03 pOTB7 BC004149 NM_012398 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380153 RBd50G09 pGCAP10 NM_012398.1  
GGCTTGTTGTTCGGCGGCGGCGGTCGCAGCTCGGGTCCCCCTCGGGCGCCCCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl