Prev. | 

RIKEN DNA Bank Human Resource - NUDCD3

Gene ID NCBI Gene 23386 |  KEGG hsa:23386
Gene Symbol NUDCD3
Protein Name NudC domain containing 3
Synonyms NudCL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001621 IRAK004A21 pCMV-SPORT6 BC003691 NM_015332 Full
HGX008984 IRAK022H16 pCMV-SPORT6 BC017657 NM_015332
HGY018490 IRAK046D18 pBluescriptR BC035014 NM_015332 Full/var
HGY090718 IRAL026N06 pOTB7 BC011673 NM_015332 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323235 RBb08B11 pKA1U5 NM_015332.3  
GACCTAGGGCGGGAGGCGACATGGAGACAGGGGCGGCCGAGCTGTATGACCAGGCCCTTT
HKR369772 RBd24H04 pGCAP10 NM_015332.3  
GAGGCGACATGGAGACAGGGGCGGCCGAGCTGTATGACCAGGCCCTTTTGGGCATCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl