Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDCD3

Gene ID (NCBI) 23386
Gene Symbol NUDCD3
Protein Name NudC domain containing 3
Synonyms NudCL
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001621 IRAK004A21 pCMV-SPORT6 BC003691 NM_015332 Full
HGX008984 IRAK022H16 pCMV-SPORT6 BC017657 NM_015332
HGY018490 IRAK046D18 pBluescriptR BC035014 NM_015332 Full/var
HGY090718 IRAL026N06 pOTB7 BC011673 NM_015332 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR323235 RBb08B11 pKA1U5 NM_015332.3
GACCTAGGGCGGGAGGCGACATGGAGACAGGGGCGGCCGAGCTGTATGACCAGGCCCTTT
HKR369772 RBd24H04 pGCAP10 NM_015332.3
GAGGCGACATGGAGACAGGGGCGGCCGAGCTGTATGACCAGGCCCTTTTGGGCATCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl