Prev. |  KEGG KO K06171 > 

RIKEN DNA Bank Human Resource - NCSTN

Gene ID NCBI Gene 23385 |  KEGG hsa:23385
Gene Symbol NCSTN
Protein Name nicastrin
Synonyms ATAG1874
Ortholog resources KEGG ortholog (KEGG orthology K06171) in the DNA Bank
Featured content Notch signaling pathway (human)
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036201 IRAK090I09 pBluescript BC047621 NM_015331 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178531 ARi46F11 pGCAP10 NM_015331.2  
GATTTATGAAAGATGGCCAGNGCAGGGGGTGGATCTTGTTTTGACCCGGGAATCCTGCTT
HKR205583 ARiS013P23 pGCAP10 NM_015331.2  
GAGAGAGGCAAGATGGCTACGGCAGGGGGTGGCTCTGGGGCTGACCCGGGAAGTCGGGGT
HKR320901 RBb02E05 pKA1U5 NM_015331.2  
GAAGATGGCTACGGCAGGGGGTGGCTCTGGGGCTGACCCGGGAAGTCGGGGTCTCCTTCG
HKR378928 RBd47F08 pGCAP10 NM_015331.2  
GAGAGAGGCAAGATGGCTACGGCAGGGGGTGGCTCTGGGGCTGACCCGGGAAGTCGGGGT
HKR380129 RBd50F09 pGCAP10 NM_015331.2  
GACGGGGGCTTCCGCTCAGCAGAGAGGCAAGATGGCTACGGCAGGGGGTGGCTCTGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl