Prev. |  KEGG KO K01251 > 

RIKEN DNA Bank Human Resource - AHCYL2

Gene ID NCBI Gene 23382 |  KEGG hsa:23382
Gene Symbol AHCYL2
Protein Name adenosylhomocysteinase like 2
Synonyms ADOHCYASE3|IRBIT2
Ortholog resources KEGG ortholog (KEGG orthology K01251) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX009014 IRAK022I22 pCMV-SPORT6 BC024325 NM_015328
HGY089434 IRAL023J18 pOTB7 BC008349 NM_015328 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113217 M01C083A17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113265 M01C083C17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113313 M01C083E17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113361 M01C083G17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113409 M01C083I17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113457 M01C083K17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113505 M01C083M17 pDONR221 IMS05-A09 BC024325 NM_015328  
HGE113553 M01C083O17 pDONR221 IMS05-A09 BC024325 NM_015328  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371604 RBd29A04 pGCAP10 NM_015328.2  
GAGTCTGAGCCGGTGGTTGCAGCGGAGGCGGTGATGTCGGTGCAGGTTGTGTCAGCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl