Prev. |  KEGG KO K12842 > 

RIKEN DNA Bank Human Resource - U2SURP

Gene ID NCBI Gene 23350 |  KEGG hsa:23350
Gene Symbol U2SURP
Protein Name U2 snRNP associated SURP domain containing
Synonyms SR140|fSAPa
Ortholog resource in our bank

  U2SURP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036333 IRAK090N21 pBluescript BC045744 XM_940802 Partial/var
HGY083861 IRAL009K21 pOTB7 BC006474 XM_940802 Partial/var
HGY100722 IRAL051N10 pDNR-LIB BC062727 XM_940802

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186857 ARi67C09 pGCAP10 NM_001080415.1  
CGGCCGGCCGATGGCCGCCGAAGGAGGGGCAAAGCTCAAGATGGCGGACAAAACGCCAGG
HKR334555 RBb36G11 pGCAP1 NM_001080415.1  
GCCGAAGGAGGGGCAAAGCTCAAGATGGCGGACAAAACGCCAGGCGGATCTCAGAAGGCC
HKR428028 RBdS070B04 pGCAP10 NM_001080415.1  
GGCCGAGGGNGGGGCAANTCTCAAGATGGCGGACAAAACGCCAGGCGGATCTCAGAAGGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl