Prev. |  KEGG KO K11366 > 

RIKEN DNA Bank Human Resource - USP22

Gene ID NCBI Gene 23326 |  KEGG hsa:23326
Gene Symbol USP22
Protein Name ubiquitin specific peptidase 22
Synonyms USP3L
Ortholog resources KEGG ortholog (KEGG orthology K11366) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103742 IRAL059F22 pOTB7 BC084550
HGY085321 IRAL013F01 pOTB7 BC007196 XM_945851 Full
HGY089627 IRAL024B03 pOTB7 BC013364 XM_945855 Partial/var
HGY096847 IRAL042B23 pOTB7 BC025317 XM_945851 Full/var
HGY098805 IRAL047A05 pOTB7 BC050994 XM_945853 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR391297 RBd78E01 pGCAP10 NM_015276.1  
GGACNCCCTCCGCGAACCGCGAGAGCGCAGCGCAGGCGGTCCGCAGCAGCCGCAGCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl