DNA Bank Top |  KEGG KO K13291 > 

RIKEN DNA Bank Human Resource - TUT4

Gene ID NCBI Gene 23318 |  KEGG hsa:23318
Gene Symbol TUT4
Protein Name terminal uridylyl transferase 4
Synonyms PAPD3|TENT3A|ZCCHC11

Link

Ortholog resource in our bank

  TUT4


External database

human TUT4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04539 SEREX clone NGO-Co-33 (ID 2271-2) #1 SEREX clone NGO-Co-33 (ID 2271-2) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031640 IRAK079B16 pCMV-SPORT6 BC035820 NM_015269 Partial/var
HGX037521 IRAK093N09 pCMV-SPORT6 BC048301 NM_015269 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050831 ARe27B07 pKA1U5 NM_015269.1  
GGCGGCGGACATGGCGGTGGAGTCCTGAGCTAGTCGTGTCCCGGCCTCCAGCGGCGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl