Prev. |  KEGG KO K13291 > 

RIKEN DNA Bank Human Resource - ZCCHC11

Gene ID NCBI Gene 23318 |  KEGG hsa:23318
Gene Symbol ZCCHC11
Protein Name zinc finger CCHC-type containing 11
Synonyms PAPD3|TUT4
Ortholog resources KEGG ortholog (KEGG orthology K13291) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04539 SEREX clone NGO-Co-33 (ID 2271-2) #1 SEREX clone NGO-Co-33 (ID 2271-2) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031640 IRAK079B16 pCMV-SPORT6 BC035820 NM_015269 Partial/var
HGX037521 IRAK093N09 pCMV-SPORT6 BC048301 NM_015269 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050831 ARe27B07 pKA1U5 NM_015269.1  
GGCGGCGGACATGGCGGTGGAGTCCTGAGCTAGTCGTGTCCCGGCCTCCAGCGGCGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl