Prev. |  KEGG KO K09313 > 

RIKEN DNA Bank Human Resource - CUX2

Gene ID NCBI Gene 23316 |  KEGG hsa:23316
Gene Symbol CUX2
Protein Name cut like homeobox 2
Synonyms CDP2|CUTL2|EIEE67
Ortholog resource in our bank

  CUX2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR379347 RBd48G03 pGCAP10 NM_015267.2  
GAGCGGCGGCGCCGGCGCCTCTCGGAGAGGCTGCCTCCCCCCAACCACTCCCCTAGACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl