Prev. |  KEGG KO K11491 > 

RIKEN DNA Bank Human Resource - NCAPD3

Gene ID NCBI Gene 23310 |  KEGG hsa:23310
Gene Symbol NCAPD3
Protein Name non-SMC condensin II complex subunit D3
Synonyms CAP-D3|CAPD3|MCPH22|hCAP-D3|hHCP-6|hcp-6
Ortholog resource in our bank

  NCAPD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049631 ARe24B07 pKA1U5 NM_015261.2  
GCTGGGATCATGGTGGCGTTGCGGGGCCTTGCCCGNNGCCTGCAGCCCTGGTGTCCGCTG
HKR416139 RBdS040F19 pGCAP10 NM_015261.2  
GGAGCCGGTGCCCTGGGATCATGGTGGCGTTGCGGGGCCTTGGTAGCGGCCTGCAGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl