Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCAPD3

Gene ID (NCBI) 23310
Gene Symbol NCAPD3
Protein Name non-SMC condensin II complex subunit D3
Synonyms CAP-D3|CAPD3|hCAP-D3|hHCP-6|hcp-6
Databases KEGG hsa:23310 |  NCBI Gene 23310
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11491)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049631 ARe24B07 pKA1U5 NM_015261.2  
GCTGGGATCATGGTGGCGTTGCGGGGCCTTGCCCGNNGCCTGCAGCCCTGGTGTCCGCTG
HKR416139 RBdS040F19 pGCAP10 NM_015261.2  
GGAGCCGGTGCCCTGGGATCATGGTGGCGTTGCGGGGCCTTGGTAGCGGCCTGCAGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl