Prev. |  KEGG KO K16685 > 

RIKEN DNA Bank Human Resource - WWC1

Gene ID NCBI Gene 23286 |  KEGG hsa:23286
Gene Symbol WWC1
Protein Name WW and C2 domain containing 1
Synonyms HBEBP3|HBEBP36|KIBRA|MEMRYQTL|PPP1R168
Featured content Hippo signaling (human)
Ortholog resource in our bank

  WWC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010987 IRAK027H19 pCMV-SPORT6 BC017746 NM_015238 Partial
HGX031292 IRAK078D20 pCMV-SPORT6 BC038463 NM_015238 Partial/var
HGY085466 IRAL013L02 pOTB7 BC004394 NM_015238 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR403077 RBdS007L13 pGCAP10 NM_015238.1  
GGGGCTCGCACCGCGCCGCTGCGGACGCACATGGCAGCGTGAGAGGCCGGCGGCGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl