Prev. | 

RIKEN DNA Bank Human Resource - TASOR

Gene ID NCBI Gene 23272 |  KEGG hsa:23272
Gene Symbol TASOR
Protein Name transcription activation suppressor
Synonyms C3orf63|FAM208A|RAP140|TASOR1|se89-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067257 IRAK168C09 pBluescriptR BC070096 NM_015224 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE123617 M01C109A17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123665 M01C109C17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123713 M01C109E17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123761 M01C109G17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123809 M01C109I17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123857 M01C109K17 pDONR221 06_15-A09 AK094486 NM_015224  
HGE123905 M01C109M17 pDONR221 06_15-A09 AK094486 NM_015224  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR397282 RBd93D10 pGCAP10 NM_015224.3  
GAGAAGAACTGCCCGAGGGAGGAGCGGCTCCGAGGACCGGGCAGCGCATTTGGGGTGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl