Prev. |  KEGG KO K07195 > 

RIKEN DNA Bank Human Resource - EXOC7

Gene ID NCBI Gene 23265 |  KEGG hsa:23265
Gene Symbol EXOC7
Protein Name exocyst complex component 7
Synonyms 2-5-3p|BLOM4|EX070|EXO70|EXOC1|Exo70p|YJL085W
Ortholog resource in our bank

  EXOC7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005140 IRAK012O04 pCMV-SPORT6 BC011045 NM_001013839 Full
HGX005354 IRAK013G10 pCMV-SPORT6 BC018466 NM_015219 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174828 ARi37B04 pGCAP10 NM_001013839.1  
GGGGGGCCCGGTGGGCCCGCGGAGGAAAGATACTGGGGAGTGGGAGCCGCGGGGTTCAGA
HKR346105 RBb65E09 pGCAP1 NM_001013839.1  
GGGGACCAAGAGCGGAAGTGGGTGTGACGGGGACGGGGGCCCGGTGGGCCCGCGGAGGAA
HKR380010 RBd50A10 pGCAP10 NM_001013839.1  
GACTGGGGAGTGGGAGCCGCGGGGTTCAGAGCGATGATTCCCCCACAGGAGGCATCCGCT
HKR430349 RBdS075O13 pGCAP10 NM_001013839.1  
GGGGGGCCCGGTGGGCCCGCGGAGGAAAGATACTGGGGAGTGGGAGCCGCGGGGTTCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl