Prev. |  KEGG KO K21596 > 

RIKEN DNA Bank Human Resource - CAMTA1

Gene ID NCBI Gene 23261 |  KEGG hsa:23261
Gene Symbol CAMTA1
Protein Name calmodulin binding transcription activator 1
Synonyms CANPMR
Ortholog resources KEGG ortholog (KEGG orthology K21596) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030345 IRAK075O09 pBluescriptR BC038183 NM_015215
HGY099058 IRAL047K18 pOTB7 BC051341 NM_015215 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043233 ARe08B09 pKA1U5 NM_015215.1  
GGGCGGCGGGGTGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCG
HKR166407 ARi16A07 pGCAP10 NM_015215.1  
GGGCGGCGGGGTGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCG
HKR186924 ARi67F04 pGCAP10 NM_015215.1  
GGTGGCTGGGCCGGCGGCGGCGGCGGTTGGAGGCGCGCGCTCGGGGACCCGGACTCTACG
HKR330883 RBb27D11 pGCAP1 NM_015215.1  
GGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCGGTCGCGAGGAGGAGGAGGATGTG
HKR334901 RBb37E05 pGCAP1 NM_015215.1  
AAATGTGGGTGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCGGT
HKR363776 RBd09H08 pGCAP10 NM_015215.1  
GGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCGGTCGCGAGGAGGAGGAGGATGTG
HKR398830 RBd97B06 pGCAP10 NM_015215.1  
TTGGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCGGTCGCGAGG
HKR430315 RBdS075N03 pGCAP10 NM_015215.1  
GGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTCGGGGTCCCGGTCGCGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl