Prev. |  KEGG KO K16545 > 

RIKEN DNA Bank Human Resource - DDHD2

Gene ID NCBI Gene 23259 |  KEGG hsa:23259
Gene Symbol DDHD2
Protein Name DDHD domain containing 2
Synonyms SAMWD1|SPG54|iPLA(1)gamma
Ortholog resource in our bank

  DDHD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007667 IRAK019C19 pCMV-SPORT6 BC010504 NM_015214 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209261 ARiS023C13 pGCAP10 NM_015214.1  
CGGCCGGCCGATGCTGGTGTTCGGCGCGAGCCCGGCGGGGCTGCAGGTTCCGCCCTGCTC
HKR368480 RBd21D08 pGCAP10 NM_015214.1  
GGCCCGTGCCCTGCGGCCCTGCACGCCCCACCCGCGGTCGCGCGCCGCGCTCCCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl