Prev. |  KEGG KO K14824 > 

RIKEN DNA Bank Human Resource - BOP1

Gene ID NCBI Gene 23246 |  KEGG hsa:23246
Gene Symbol BOP1
Protein Name block of proliferation 1
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K14824) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005480 IRAK013L16 pCMV-SPORT6 BC013787 NM_015201 Full
HGY080966 IRAL002G22 pOTB7 BC001086 NM_015201 Partial
HGY084647 IRAL011K07 pOTB7 BC005160 NM_015201 Partial
HGY089010 IRAL022I18 pOTB7 BC007274 NM_015201 Partial
HGY090958 IRAL027G14 pOTB7 BC013980 NM_015201 Full
HGY103312 IRAL058E16 pOTB7 BC073813 NM_015201 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042659 W01A106K19 pENTR-TOPO IRAK013L16 BC013787 NM_015201  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR180169 ARi50H01 pGCAP10 NM_015201.3  
GGGGGCGCGTCCTCCTGCGCACGCGGCCCGGTCGCTGTCGGAAGCGGCTGTGCGGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl