Prev. |  KEGG KO K11267 > 

RIKEN DNA Bank Human Resource - PDS5A

Gene ID NCBI Gene 23244 |  KEGG hsa:23244
Gene Symbol PDS5A
Protein Name PDS5 cohesin associated factor A
Synonyms PIG54|SCC-112|SCC112
Ortholog resources KEGG ortholog (KEGG orthology K11267) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238644 ARiS096K04 pGCAP10 NM_001100399.1  
GTGACCGGCCNTTGTGTGCNCTANGCCCCGGCTCCCGGGGCACGGACGGCCGGGCGCGCG
HKR320852 RBb02C04 pKA1U5 NM_001100399.1 done
GGGAGGCGGATGCACGGCCGGCGGAGGAAGGGGAGGGAGCGAGGAGCGCGCGCTGCTCTC
HKR372902 RBd32E06 pGCAP10 NM_001100399.1  
GGGAAGTTTAGGGAGCGAGGAGCGCGCGCTGCTCTCGCGTGCTCTCGCGCCGCTCGCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl