Prev. |  KEGG KO K16311 > 

RIKEN DNA Bank Human Resource - SIK2

Gene ID NCBI Gene 23235 |  KEGG hsa:23235
Gene Symbol SIK2
Protein Name salt inducible kinase 2
Synonyms LOH11CR1I|QIK|SIK-2|SNF1LK2
Ortholog resource in our bank

  SIK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008775 IRAK021P15 pCMV-SPORT6 BC013612 NM_015191 Partial
HGX069775 IRAK174H07 pCMV-SPORT6 BC078150 NM_015191 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR187331 ARi68F11 pGCAP10 NM_015191.1  
GGTGGATTTTTCTGTCTCAGCAGTGCAGAAACTGAGTTTCCTCTCTCCCCTGGCGTTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl