Prev. |  KEGG KO K19346 > 

RIKEN DNA Bank Human Resource - SYNE2

Gene ID NCBI Gene 23224 |  KEGG hsa:23224
Gene Symbol SYNE2
Protein Name spectrin repeat containing nuclear envelope protein 2
Synonyms EDMD5|KASH2|NUA|NUANCE|Nesp2|Nesprin-2|SYNE-2|TROPH
Ortholog resource in our bank

  SYNE2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04928 SEREX clone NGO-Pr-29 (ID 634, 2298) #1 SEREX clone NGO-Pr-29 (ID 634, 2298) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031472 IRAK078L08 pCMV-SPORT6 BC036941 NM_015180 Partial/var
HGY103328 IRAL058F08 pOTB7 BC071873 NM_015180 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR381776 RBd54H08 pGCAP10 NM_015180.4  
GAGGTTTGGAAACAACAGCCGCTTGAGTTGAAGGCTTTTTACCCCCTTCTTGTGATTAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl