Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARL6IP1

Gene ID (NCBI) 23204
Gene Symbol ARL6IP1
Protein Name ADP-ribosylation factor-like 6 interacting protein 1
Synonyms AIP1|ARL6IP|ARMER
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001577 IRAK003P17 pCMV-SPORT6 BC010281 NM_015161

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE004660 W01A011K20 pENTR-TOPO IRAK003P17 BC010281 NM_015161

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR080874 ARf02D02 pKA1U5 NM_015161.1
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGATTGGGGAGGTGGCCTGCGC
HKR165729 ARi14F09 pGCAP10 NM_015161.1
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCT
HKR055656 ARe39C08 pKA1U5 NM_015161.1
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGNACTCNATTGGGGAGGTGGCCTGCGCT
HKR062952 ARe57G08 pKA1U5 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACNCTTTGGGGAGGTGGCCTGCGCTTGTAG
HKR185633 ARi64B09 pGCAP10 NM_015161.1
HKR073252 ARe83C04 pKA1U5 NM_015161.1
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGNTTGGGGAGGTGGCCTGCGC
HKR074803 ARe87A03 pKA1U5 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR208315 ARiS020N03 pGCAP10 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCNCTNNNNN
HKR243658 ARiS109C10 pGCAP10 NM_015161.1
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGNCTGNNCTN
HKR248915 ARiS122E19 pGCAP10 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR276578 ARiS191H10 pGCAP10 NM_015161.1
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTT
HKR276690 ARiS191M02 pGCAP10 NM_015161.1
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCT
HKR371332 RBd28F12 pGCAP10 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR379202 RBd48A02 pGCAP10 NM_015161.1
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGGCTGCGCT
HKR405738 RBdS014F18 pGCAP10 NM_015161.1
GGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTG
HKR452901 RBdS132E05 pGCAP10 NM_015161.1
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl