DNA Bank Top |  KEGG KO K24864 > 

RIKEN DNA Bank Human Resource - ARL6IP1

Gene ID NCBI Gene 23204 |  KEGG hsa:23204
Gene Symbol ARL6IP1
Protein Name ADP ribosylation factor like GTPase 6 interacting protein 1
Synonyms AIP1|ARL6IP|ARMER|SPG61

Link

Ortholog resource in our bank

  ARL6IP1


External database

human ARL6IP1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14568 pCI-neo/GFP-ARL6ip1(42-133+KKNE) Expression vector of N-terminal GFP plus 42-133aa of human ARL6ip1.    
RDB14567 pCI-neo/GFP-ARL6ip1(delta42-86) Expression vector of N-terminal GFP plus human ARL6ip1, deletion mutant, delta 42-86 a.a.    
RDB14566 pCI-neo/GFP-ARL6ip1(delta1-133) Expression vector of N-terminal GFP plus human ARL6ip1, deletion mutant, delta 1-133 a.a    
RDB14565 pCI-neo/GFP-ARL6ip1(delta1-86) Expression vector of N-terminal GFP plus human ARL6ip1, deletion mutant, delta 1-86 a.a.    
RDB14564 pCI-neo/GFP-ARL6ip1(delta1-41) Expression vector of N-terminal GFP plus human ARL6ip1, deletion mutant, delta 1-41 a.a.    
RDB14563 pCI-neo/GFP-ARL6ip1(WT) Expression vector of N-terminal GFP plus human ARL6ip1, wild type.    
RDB14562 pCI-neo/ARL6ip1(1-199)-Gluc-ARL6ip1(200-203) [E199] Expression vector of human ARL6ip1 plus Gluc inserted after Glu at 199aa.    
RDB14561 pCI-neo/ARL6ip1(1-189)-Gluc-ARL6ip1(190-203) [R189] Expression vector of human ARL6ip1 plus Gluc inserted after Arg at 189aa.    
RDB14560 pCI-neo/ARL6ip1(1-119)-Gluc-ARL6ip1(120-203) [A119] Expression vector of human ARL6ip1 plus Gluc inserted after Ala at 119aa.    
RDB14559 pCI-neo/ARL6ip1(1-99)-Gluc-ARL6ip1(100-203) [T99] Expression vector of human ARL6ip1 plus Gluc inserted after Thr at 99aa.    
RDB14558 pCI-neo/ARL6ip1(1-90)-Gluc-ARL6ip1(91-203) [R90] Expression vector of human ARL6ip1 plus Gluc inserted after Arg at 90aa.    
RDB14557 pCI-neo/ARL6ip1(1-64)-Gluc [P64*] Expression vector of N-terminal 64aa of human ARL6ip1 plus Gluc.    
RDB14556 pCI-neo/ARL6ip1(1-64)-Gluc-ARL6ip1(65-203) [P64] Expression vector of human ARL6ip1 plus Gluc inserted after Pro at 64aa.    
RDB14555 pCI-neo/ARL6ip1(1-37)-Gluc-ARL6ip1(38-203) [L37] Expression vector of human ARL6ip1 plus Gluc inserted after Leu at 37aa.    
RDB14554 pCI-neo/ARL6ip1(1-29)-Gluc-ARL6ip1(30-203) [V29] Expression vector of human ARL6ip1 plus Gluc inserted after Val at 29aa.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001577 IRAK003P17 pCMV-SPORT6 BC010281 NM_015161

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004660 W01A011K20 pENTR-TOPO IRAK003P17 BC010281 NM_015161  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055656 ARe39C08 pKA1U5 NM_015161.1  
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGNACTCNATTGGGGAGGTGGCCTGCGCT
HKR062952 ARe57G08 pKA1U5 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACNCTTTGGGGAGGTGGCCTGCGCTTGTAG
HKR073252 ARe83C04 pKA1U5 NM_015161.1  
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGNTTGGGGAGGTGGCCTGCGC
HKR074803 ARe87A03 pKA1U5 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR080874 ARf02D02 pKA1U5 NM_015161.1  
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGATTGGGGAGGTGGCCTGCGC
HKR165729 ARi14F09 pGCAP10 NM_015161.1  
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCT
HKR185633 ARi64B09 pGCAP10 NM_015161.1  
HKR208315 ARiS020N03 pGCAP10 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCNCTNNNNN
HKR243658 ARiS109C10 pGCAP10 NM_015161.1  
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGNCTGNNCTN
HKR248915 ARiS122E19 pGCAP10 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR276578 ARiS191H10 pGCAP10 NM_015161.1  
GGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTT
HKR276690 ARiS191M02 pGCAP10 NM_015161.1  
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCT
HKR371332 RBd28F12 pGCAP10 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG
HKR379202 RBd48A02 pGCAP10 NM_015161.1  
GGGGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGGCTGCGCT
HKR405738 RBdS014F18 pGCAP10 NM_015161.1  
GGTTGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTG
HKR452901 RBdS132E05 pGCAP10 NM_015161.1  
GGTGGTTGGTGTGCGGGTTTCGGTTGGAGGACTCGTTGGGGAGGTGGCCTGCGCTTGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl