Prev. |  KEGG KO K18726 > 

RIKEN DNA Bank Human Resource - FAF2

Gene ID NCBI Gene 23197 |  KEGG hsa:23197
Gene Symbol FAF2
Protein Name Fas associated factor family member 2
Synonyms ETEA|UBXD8|UBXN3B
Ortholog resources KEGG ortholog (KEGG orthology K18726) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081172 IRAL002P12 pOTB7 BC001069 NM_014613 Full
HGY084083 IRAL010D11 pOTB7 BC001069 NM_014613 Full
HGY087475 IRAL018L11 pOTB7 BC006145 NM_014613 Full
HGY091327 IRAL028F07 pOTB7 BC014001 NM_014613 Full
HGY093833 IRAL034J17 pOTB7 BC015791 NM_014613 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074055 ARe85C07 pKA1U5 NM_014613.2  
GAGGAGCGTAGAGGCGGCGGCAAAATGGCGGCGCCTGAGGAGCGGGATCTAACCCAGGAG
HKR442174 RBdS105H06 pGCAP10 NM_014613.2  
GGTCAGTTCCGGCGGGTGACGGTGCGGACGGGTCAGGAGCGTAGAGGCGGCGGCAAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl