Prev. |  KEGG KO K05546 > 

RIKEN DNA Bank Human Resource - GANAB

Gene ID NCBI Gene 23193 |  KEGG hsa:23193
Gene Symbol GANAB
Protein Name glucosidase II alpha subunit
Synonyms G2AN|GIIA|GLUII|PKD3
Ortholog resources KEGG ortholog (KEGG orthology K05546) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056277 IRAK140L13 pCMV-SPORT6 BC065266 NM_198335 Full/var
HGX001706 IRAK004E10 pCMV-SPORT6 BC005405 NM_198335 Partial
HGY080858 IRAL002C10 pOTB7 BC017433 NM_198335 Partial
HGY084337 IRAL010O01 pOTB7 BC017435 NM_198335 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055674 ARe39D02 pKA1U5 NM_198334.1  
GAAACTCTGCACAAGATGGCGGCGGTTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTTG
HKR062034 ARe55B10 pKA1U5 NM_198334.1  
GCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCNGNNCGNTAGGAGGCGGTCTTGGGCGT
HKR162849 ARi07C01 pGCAP10 NM_198334.1  
GGCAAACTCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTT
HKR188011 ARi70A11 pGCAP10 NM_198334.1  
GGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTTGGGCGTCTT
HKR209335 ARiS023F15 pGCAP10 NM_198334.1  
GAAACTCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTTGG
HKR247354 ARiS118G10 pGCAP10 NM_198334.1  
GCGTAGGAGGNGGTCTTGGNCGTCTTTGGTACTGGCTTTTTTAGGGGTCTGCCTGGGGAT
HKR277808 ARiS194I16 pGCAP10 NM_198334.1  
GCTCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTTGGGCG
HKR341203 RBb53A03 pGCAP1 NM_198334.1  
GGCACAAGATGGCGGCGGTAGCGGCAGATGGCGGCGCGCTAGGAGGCGGTCTTGGGCGTC
HKR369233 RBd23B09 pGCAP10 NM_198334.1  
GAAAACTCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCGGTCTTG
HKR396835 RBd92B11 pGCAP10 NM_198334.1  
GAAGGAGCAAACTCTGCACAAGATGGCGGCGGTAGCGGCAGTGGCGGCGCGTAGGAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl