Prev. |  KEGG KO K16609 > 

RIKEN DNA Bank Human Resource - TTLL12

Gene ID NCBI Gene 23170 |  KEGG hsa:23170
Gene Symbol TTLL12
Protein Name tubulin tyrosine ligase like 12
Synonyms dJ526I14.2
Ortholog resource in our bank

  TTLL12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083001 IRAL007I09 pOTB7 BC001070 NM_015140 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097232 M01C043B08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097280 M01C043D08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097328 M01C043F08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097376 M01C043H08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097424 M01C043J08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097472 M01C043L08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097520 M01C043N08 pDONR221 MGC11-D04 BC001070 NM_015140  
HGE097568 M01C043P08 pDONR221 MGC11-D04 BC001070 NM_015140  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR441940 RBdS104O04 pGCAP10 NM_015140.2  
GGGCCTGCGGAGCGTAGCAGCCCGGGCCAGACGCCGGAGGAGGGCGCGCAGGCCTTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl