Prev. | 

RIKEN DNA Bank Human Resource - MPRIP

Gene ID NCBI Gene 23164 |  KEGG hsa:23164
Gene Symbol MPRIP
Protein Name myosin phosphatase Rho interacting protein
Synonyms M-RIP|MRIP|RHOIP3|RIP3|p116Rip
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04587 SEREX clone NGO-Br-66 (ID 1306, 1307) #1 SEREX clone NGO-Br-66 (ID 1306, 1307) #1
RDB04842 SEREX clone NGO-Pr-183 5': (ID 2538) ; NGO-Pr-183 3': (ID 2539) #1 SEREX clone NGO-Pr-183 5' (ID 2538); NGO-Pr-183 3' (ID 2539) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008415 IRAK021A15 pCMV-SPORT6 BC012426 NM_201274
HGX053808 IRAK134I16 pCMV-SPORT6 BC063588 NM_201274 Partial/var
HGY090492 IRAL026D20 pOTB7 BC009982 NM_201274 Partial/var
HGY092011 IRAL030A11 pOTB7 BC014102 NM_201274 Partial/var
HGY103497 IRAL058M09 pOTB7 BC075847 NM_201274 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR183679 ARi59D07 pGCAP10 NM_015134.2  
GATTTGCAGCGGCCGCGGGGCGCCGAGGGCAGCTGCGGCGGCGCGGACGAGCCGGGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl