Prev. |  KEGG KO K12404 > 

RIKEN DNA Bank Human Resource - GGA3

Gene ID NCBI Gene 23163 |  KEGG hsa:23163
Gene Symbol GGA3
Protein Name golgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K12404) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15367 pGEX-4T-2/hGGA3(GAT) Bacterial Expression vector of human GGA3, the GGA homology domain.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053483 IRAK133L19 pBluescript BC063285 NM_138619 Full/var
HGY066887 IRAK167D15 pBluescriptR BC070044 NM_014001 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR326002 RBb15A02 pKA1U5 NM_138619.1  
TGGGGCCGGGCGGCTGCAATATGGCGGAGGCGNAAGGGGAAAGCCTGGAGTCCTGGCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.10.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl