DNA Bank Top |  KEGG KO K19951 > 

RIKEN DNA Bank Human Resource - TBC1D9

Gene ID NCBI Gene 23158 |  KEGG hsa:23158
Gene Symbol TBC1D9
Protein Name TBC1 domain family member 9
Synonyms GRAMD9|MDR1

Link

Ortholog resource in our bank

  TBC1D9


External database

human TBC1D9

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20825 pEGFP-C1-TBC1D9A-R566K Expression vector of human TBC1D9A GAP-activity-deficient mutant (R566K) tagged with EGFP at N-terminus    
RDB14992 pEGFP-C1-human TBC1D9A Expression vector of human TBC1 domain family member 9 (TBC1D9), fused with N-terminal EGFP, CMV promoter.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031233 IRAK078B09 pCMV-SPORT6 BC038804 NM_015130 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2025Apr02.csv
GNP_full_IRAL_2025Apr02.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072808 ARe82A08 pKA1U5 NM_015130.2  
GGGGCTGCAGAGTGCCAGGCCGGGCGTCTGCGGCCGCGGGCTCTCGCGGGGCGGCGACNC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_20250404.csv
NRCDhumcloneList_RB_20250404.csv


2025.04.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl