Prev. | 

RIKEN DNA Bank Human Resource - CLCC1

Gene ID NCBI Gene 23155 |  KEGG hsa:23155
Gene Symbol CLCC1
Protein Name chloride channel CLIC like 1
Synonyms MCLC
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086294 IRAL015M06 pOTB7 BC002939 NM_015127 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098437 M01C046B13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098485 M01C046D13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098533 M01C046F13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098581 M01C046H13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098629 M01C046J13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098677 M01C046L13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098725 M01C046N13 pDONR221 MGC12-G07 BC002939 ENST00000369970  
HGE098773 M01C046P13 pDONR221 MGC12-G07 BC002939 ENST00000369970  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR377732 RBd44F12 pGCAP10 NM_001048210.1  
GGCTGAAACCCTGGGCGGCGGCAAGCTGTGCGACCTCTTCTGCGGCCGGCCTGGACTAGC
HKR444086 RBdS110D14 pGCAP10 NM_001048210.1  
GAGGAAGCACGCTGAAACCCTGGGCGGCGGCAAGCTGTGCGACCTCTTCTGCGGCCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl