Prev. | 

RIKEN DNA Bank Human Resource - SMC5

Gene ID NCBI Gene 23137 |  KEGG hsa:23137
Gene Symbol SMC5
Protein Name structural maintenance of chromosomes 5
Synonyms SMC5L1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080818 M01C002A18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE080866 M01C002C18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE080914 M01C002E18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE080962 M01C002G18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE081010 M01C002I18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE081058 M01C002K18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE081106 M01C002M18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE081154 M01C002O18 pDONR221 04-134-2_1-F09 BC038225 ENST00000377144  
HGE110040 M01C075B16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110088 M01C075D16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110136 M01C075F16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110184 M01C075H16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110232 M01C075J16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110280 M01C075L16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110328 M01C075N16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE110376 M01C075P16 pDONR221 06-2_01-D08 BC038225 ENST00000377144  
HGE093629 M01C034B05 pDONR221 MGC06-G03 BC038225 ENST00000377144  
HGE093677 M01C034D05 pDONR221 MGC06-G03 BC038225 ENST00000377144  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366554 RBd16G10 pGCAP10 NM_015110.3 done
GGGGAGCGAGCGCGCGGTAACAGTTCGCGGCAGTTCGCGCGGGAGCGGGGCGCCTGGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl