Prev. |  KEGG KO K06107 > 

RIKEN DNA Bank Human Resource - EPB41L3

Gene ID NCBI Gene 23136 |  KEGG hsa:23136
Gene Symbol EPB41L3
Protein Name erythrocyte membrane protein band 4.1 like 3
Synonyms 4.1B|DAL-1|DAL1
Ortholog resource in our bank

  EPB41L3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087483 IRAL018L19 pOTB7 BC006141 NM_012307 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098825 M01C047B01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE098873 M01C047D01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE098921 M01C047F01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE098969 M01C047H01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE099017 M01C047J01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE099065 M01C047L01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE099113 M01C047N01 pDONR221 MGC13-C01 BC006141 ENST00000342933  
HGE099161 M01C047P01 pDONR221 MGC13-C01 BC006141 ENST00000342933  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042107 ARe05E11 pKA1U5 NM_012307.2  
GAGTCTCCTGCGCACCGCCGCCGAGGACGCGCGCCCGAGCCTAGTCCCCACGCCGCGGCG
HKR056155 ARe40G11 pKA1U5 NM_012307.2  
GAGTCTCCTGCGCACCGCCGCCGAGGACGCGCGCCCNAGCCTAGTCCCCACGCCGCGGCG
HKR169256 ARi23C08 pGCAP10 NM_012307.2  
GACGCCCGAGTCTCCTGCGCACCGCCGCCGAGGACGCGCGCCCGAGCCTAGTCCCCACGC
HKR174573 ARi36H05 pGCAP10 NM_012307.2  
GAGTCTCCTGCGCACCGCCGCCGAGGACGCGCGCCCGAGCCTAGTCCCCACGCCGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl