Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SPG20

Gene ID (NCBI) 23111
Gene Symbol SPG20
Protein Name spastic paraplegia 20 (Troyer syndrome)
Synonyms SPARTIN|TAHCCP1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03825 SEREX clone NGO-St-072 (ID 326, 327) #1 SEREX clone NGO-St-072 (ID 326, 327) #1
RDB04801 SEREX clone NGO-Pr-140 (ID 2505) #1 SEREX clone NGO-Pr-140 (ID 2505) #1

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY036718 IRAK091N06 pBluescript BC047083 NM_015087 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061699 ARe54E03 pKA1U5 NM_015087.4  
GGGGGGGTCTGCGCGGGGCCGCTGACTCGCGAGGTTCTCTGTCGCCTGCCGCCCTCGCTC
HKR248991 ARiS122H23 pGCAP10 NM_015087.4  
GGGCGGCGTGCTGCGGACTCTGTGGCGGGAGCGAGGCCGACGGGCGGGGCCGCGCGGCCG
HKR264662 ARiS161K22 pGCAP10 NM_015087.4  
GGAGCGCAGCGGCGCCCAGTGTAAGGGAGTGGGAGCTGGTCCGTGCCGCGGCGGCCGCGC
HKR277689 ARiS194D17 pGCAP10 NM_015087.4  
AGGTCAAAAGGAANANNCNAANNNCNCCNNCNNCCCAGGAANGGGACNGNTGCTCAGAGG
HKR360853 RBd02C05 pGCAP10 NM_015087.4  
TGAGTGTAAGGGAGTGGGAGCTGGTCCGTGCCGCGGCGGCCGCGCAGGGAGCTCTCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl