Prev. |  KEGG KO K19366 > 

RIKEN DNA Bank Human Resource - SPART

Gene ID NCBI Gene 23111 |  KEGG hsa:23111
Gene Symbol SPART
Protein Name spartin
Synonyms SPG20|TAHCCP1
Featured content Endocytosis (human)
Ortholog resource in our bank

  SPART

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03825 SEREX clone NGO-St-072 (ID 326, 327) #1 SEREX clone NGO-St-072 (ID 326, 327) #1
RDB04801 SEREX clone NGO-Pr-140 (ID 2505) #1 SEREX clone NGO-Pr-140 (ID 2505) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036718 IRAK091N06 pBluescript BC047083 NM_015087 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061699 ARe54E03 pKA1U5 NM_015087.4  
GGGGGGGTCTGCGCGGGGCCGCTGACTCGCGAGGTTCTCTGTCGCCTGCCGCCCTCGCTC
HKR248991 ARiS122H23 pGCAP10 NM_015087.4  
GGGCGGCGTGCTGCGGACTCTGTGGCGGGAGCGAGGCCGACGGGCGGGGCCGCGCGGCCG
HKR264662 ARiS161K22 pGCAP10 NM_015087.4  
GGAGCGCAGCGGCGCCCAGTGTAAGGGAGTGGGAGCTGGTCCGTGCCGCGGCGGCCGCGC
HKR277689 ARiS194D17 pGCAP10 NM_015087.4  
AGGTCAAAAGGAANANNCNAANNNCNCCNNCNNCCCAGGAANGGGACNGNTGCTCAGAGG
HKR360853 RBd02C05 pGCAP10 NM_015087.4  
TGAGTGTAAGGGAGTGGGAGCTGGTCCGTGCCGCGGCGGCCGCGCAGGGAGCTCTCGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl