Prev. | 

RIKEN DNA Bank Human Resource - SARM1

Gene ID NCBI Gene 23098 |  KEGG hsa:23098
Gene Symbol SARM1
Protein Name sterile alpha and TIR motif containing 1
Synonyms MyD88-5|SAMD2|SARM
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336573 RBb41H05 pGCAP1 NM_015077.2  
TGTCCCAGCTTCAGCCGAGCCCGTGCCCAGGCCACGCTTTGTTCCAGCCGCCGCCTCCTC
HKR462720 RBdS156N08 pGCAP10 NM_015077.2  
GNNNTNNCTTCTTCNCCATGTCGGGCCCACGGCCGGGCGCCGAGCGGCTGGCGGTGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl