Prev. | 

RIKEN DNA Bank Human Resource - ZC3H13

Gene ID NCBI Gene 23091 |  KEGG hsa:23091
Gene Symbol ZC3H13
Protein Name zinc finger CCCH-type containing 13
Synonyms KIAA0853|Xio
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044250 IRAK110K10 pCMV-SPORT6 BC050658 NM_015070 Partial/var
HGY092013 IRAL030A13 pOTB7 BC019000 NM_015070 Partial/var
HGY100782 IRAL051P22 pDNR-LIB BC062685 NM_015070

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069211 ARe73A11 pKA1U5 NM_015070.3  
CCGGCGGCATTTTGAGGCGGTCCTCCTAGCGGCCTGGATAGTGTTTTTGTTGCCTTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl