Prev. | 

RIKEN DNA Bank Human Resource - PEG10

Gene ID NCBI Gene 23089 |  KEGG hsa:23089
Gene Symbol PEG10
Protein Name paternally expressed 10
Synonyms EDR|HB-1|MEF3L|Mar2|Mart2|RGAG3|RTL2|SIRH1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011098 IRAK027M10 pCMV-SPORT6 BC015448 XM_940378 Partial/var
HGX044315 IRAK110N03 pCMV-SPORT6 BC050659 XM_940371 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095229 M01C038B05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095277 M01C038D05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095325 M01C038F05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095373 M01C038H05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095421 M01C038J05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095469 M01C038L05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095517 M01C038N05 pDONR221 MGC08-G03 BC050659 NM_001040152  
HGE095565 M01C038P05 pDONR221 MGC08-G03 BC050659 NM_001040152  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387700 RBd69E04 pGCAP10 NM_001040152.1  
GACACGCGCTTCAACTTCGGTTGGTGTGTGTCGAAGAAACCTGACTGCGCCCTGAGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl