Prev. |  KEGG KO K14589 > 

RIKEN DNA Bank Human Resource - CMTR1

Gene ID NCBI Gene 23070 |  KEGG hsa:23070
Gene Symbol CMTR1
Protein Name cap methyltransferase 1
Synonyms FTSJD2|KIAA0082|MTr1|hMTr1
Ortholog resources KEGG ortholog (KEGG orthology K14589) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005768 IRAK014G24 pCMV-SPORT6 BC010731 NM_015050 Partial
HGX017007 IRAK042I15 pCMV-SPORT6 BC031890 NM_015050

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080823 M01C002A23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE080871 M01C002C23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE080919 M01C002E23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE080967 M01C002G23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE081015 M01C002I23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE081063 M01C002K23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE081111 M01C002M23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE081159 M01C002O23 pDONR221 04-134-2_1-E12 BC031890 NM_015050  
HGE110045 M01C075B21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110093 M01C075D21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110141 M01C075F21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110189 M01C075H21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110237 M01C075J21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110285 M01C075L21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110333 M01C075N21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE110381 M01C075P21 pDONR221 06-2_01-C11 BC031890 NM_015050  
HGE092818 M01C032A18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE092866 M01C032C18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE092914 M01C032E18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE092962 M01C032G18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE093010 M01C032I18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE093058 M01C032K18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE093106 M01C032M18 pDONR221 MGC05-F09 BC031890 NM_015050  
HGE093154 M01C032O18 pDONR221 MGC05-F09 BC031890 NM_015050  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209458 ARiS023K18 pGCAP10 NM_015050.2  
GGCAGTACTGGACCCGAGCGCGACGGTGCGGCTGGCGGACCCGGGCTGGCTTGTGGGGAA
HKR433222 RBdS083A22 pGCAP10 NM_015050.2  
CGGCCGGCCGATGGTCCGTGACGTCATCAGGCTGCGCTGCCCGCAGTACTGGACCCGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl