Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GGA2

Gene ID (NCBI) 23062
Gene Symbol GGA2
Protein Name golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms VEAR
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082504 IRAL006E08 pOTB7 BC000284 NM_015044 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082008 M01C005A08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082056 M01C005C08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082104 M01C005E08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082152 M01C005G08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082200 M01C005I08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082248 M01C005K08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082296 M01C005M08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082344 M01C005O08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE126813 M01C117A13 pDONR221 3_5-A07 AK024619 NM_015044  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR391634 RBd79B10 pGCAP10 NM_015044.3  
GGGCGTCGGGGCTGGAGCGATGGCGGCGACCGCGGTGGCGGCGGCTGTGGCGGGAACCGA
HKR394484 RBd86D12 pGCAP10 NM_015044.3  
GGGCGTCTGGGCTGGAGCGATGGCGGCGACCGCGGTGGCGGCGGCTGTGGCGGGAACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl