Prev. |  KEGG KO K12404 > 

RIKEN DNA Bank Human Resource - GGA2

Gene ID NCBI Gene 23062 |  KEGG hsa:23062
Gene Symbol GGA2
Protein Name golgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms VEAR
Featured content Lysosome (human)
Ortholog resource in our bank

  GGA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082504 IRAL006E08 pOTB7 BC000284 NM_015044 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082008 M01C005A08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082056 M01C005C08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082104 M01C005E08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082152 M01C005G08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082200 M01C005I08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082248 M01C005K08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082296 M01C005M08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE082344 M01C005O08 pDONR221 04-134-2_3-B04 AK024619 NM_015044  
HGE126813 M01C117A13 pDONR221 3_5-A07 AK024619 NM_015044  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR391634 RBd79B10 pGCAP10 NM_015044.3  
GGGCGTCGGGGCTGGAGCGATGGCGGCGACCGCGGTGGCGGCGGCTGTGGCGGGAACCGA
HKR394484 RBd86D12 pGCAP10 NM_015044.3  
GGGCGTCTGGGCTGGAGCGATGGCGGCGACCGCGGTGGCGGCGGCTGTGGCGGGAACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl