Prev. | 

RIKEN DNA Bank Human Resource - PDXDC1

Gene ID NCBI Gene 23042 |  KEGG hsa:23042
Gene Symbol PDXDC1
Protein Name pyridoxal dependent decarboxylase domain containing 1
Synonyms LP8165
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019167 IRAK047P07 pBluescriptR BC036520 NM_015027 Full/var
HGX035251 IRAK088C03 pCMV-SPORT6 BC042104 NM_015027 Partial
HGY042750 IRAK106O14 pBluescript BC045554 NM_015027
HGY053438 IRAK133J22 pBluescript BC060871 NM_015027
HGY085888 IRAL014L24 pOTB7 BC025366 NM_015027 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE091242 M01C028B18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091290 M01C028D18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091338 M01C028F18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091386 M01C028H18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091434 M01C028J18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091482 M01C028L18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091530 M01C028N18 pDONR221 MGC03-H09 BC060871 ENST00000325823  
HGE091578 M01C028P18 pDONR221 MGC03-H09 BC060871 ENST00000325823  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247431 ARiS118J15 pGCAP10 NM_015027.2  
CGGCCGGCCGATGGGGCGCGGGGGACGTCAGCGCTGCCAGCGTGGAAGGAGCTGCGGG
HKR402921 RBdS007F01 pGCAP10 NM_015027.2  
GGCCGCCTGGCAGCTCCTCCTCTTCTCCGCCCCGCCGGCCGCGGGCGCGGGGGACGTCAG
HKR405386 RBdS013H18 pGCAP10 NM_015027.2  
GGCCGCCTGGCANCTCCNCCTCTTCTCCGCCCCGCCGGCCGCGGGCGCGGGGGACGTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl