Prev. | 

RIKEN DNA Bank Human Resource - GOLGA8A

Gene ID NCBI Gene 23015 |  KEGG hsa:23015
Gene Symbol GOLGA8A
Protein Name golgin A8 family member A
Synonyms GM88
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053752 IRAK134G08 pCMV-SPORT6 BC064341 NM_181077 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR328428 RBb21B04 pKA1U5 NM_181077.2  
GCTAATTAGCAGTCGCGGTGTGCCGCTACGTGCGGGCTCTCAAGGAGCTCAGCCTCCCGG
HKR471035 RBdS177J19 pGCAP10 NM_181077.2  
GAGCTTCCGGGCTAATTNNCAGTCGCGGTGTGCCNCTACGTGCGGGCTCTCAAGGAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl