Prev. | 

RIKEN DNA Bank Human Resource - KLHDC10

Gene ID NCBI Gene 23008 |  KEGG hsa:23008
Gene Symbol KLHDC10
Protein Name kelch domain containing 10
Synonyms slim
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018817 IRAK047A17 pBluescriptR BC036464 NM_014997 Full
HGY036499 IRAK091E03 pBluescript BC044884 NM_014997 Full/var
HGY090478 IRAL026D06 pOTB7 BC009977 NM_014997 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219912 ARiS049M24 pGCAP10 NM_014997.2 done
GGGGTCTCTGGAGGAGCCCAGGAAGGAGGCTCCGCTGGTTCCGCTGGGTCAGGCGCTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl