Prev. | 

RIKEN DNA Bank Human Resource - HMGXB3

Gene ID NCBI Gene 22993 |  KEGG hsa:22993
Gene Symbol HMGXB3
Protein Name HMG-box containing 3
Synonyms HMGX3|SMF
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011824 IRAK029J08 pCMV-SPORT6 BC035219 XM_940209 Partial
HGX037303 IRAK093E07 pCMV-SPORT6 BC051025 XM_940209 Partial/var
HGX053836 IRAK134J20 pCMV-SPORT6 BC063691 XM_940209 Partial
HGY084655 IRAL011K15 pOTB7 BC005880 XM_940209 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203201 ARiS008A01 pGCAP10 NM_014983.1  
GGGCGATCCGTGGTGTGCCGCTACTGCCGGTGCAGCCGCCAAACCGGTGCCTCGGTGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl