Prev. |  KEGG KO K16812 > 

RIKEN DNA Bank Human Resource - TPX2

Gene ID NCBI Gene 22974 |  KEGG hsa:22974
Gene Symbol TPX2
Protein Name TPX2 microtubule nucleation factor
Synonyms C20orf1|C20orf2|DIL-2|DIL2|FLS353|GD:C20orf1|HCA519|HCTP4|REPP86|p100
Ortholog resource in our bank

  TPX2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03779 SEREX clone NGO-St-023 (ID 44, 45) #1 SEREX clone NGO-St-023 (ID 44, 45) #1
RDB03781 SEREX clone NGO-St-023 (ID 44, 45) #2 SEREX clone NGO-St-023 (ID 44, 45) #2
RDB03797 SEREX clone NGO-St-023 (ID 44, 45) #4 SEREX clone NGO-St-023 (ID 44, 45) #4

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005034 IRAK012J18 pCMV-SPORT6 BC011357 NM_012112 Partial
HGY082840 IRAL007B16 pOTB7 BC004136 NM_012112 Full
HGY096355 IRAL040O19 pOTB7 BC020207 NM_012112 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025871 W01A064L07 pENTR-TOPO IRAL007B16 BC004136 NM_012112  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048833 ARe22B09 pKA1U5 NM_012112.4  
GAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGGGCGCGG
HKR051770 ARe29H02 pKA1U5 NM_012112.4  
GAGGTGAGCCGCTGGGTAAGAAAAGAGGGAGCAGCCTAGGGCGCGGGTCTCCCTCCTCCC
HKR069376 ARe73H08 pKA1U5 NM_012112.4  
GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCCCNTTAAAGAAAAGAGGGAGCAGCTAG
HKR346132 RBb65F12 pGCAP1 NM_012112.4  
GGCTTCGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAG
HKR346175 RBb65H07 pGCAP1 NM_012112.4  
GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGG
HKR432486 RBdS081D14 pGCAP10 NM_012112.4  
GGTTGTCAGATCTGAGGCGAGGCTAGGTGAGCCGTGGGAAGAAAAGAGGGAGCAGCTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl