Prev. |  KEGG KO K11461 > 

RIKEN DNA Bank Human Resource - SCMH1

Gene ID NCBI Gene 22955 |  KEGG hsa:22955
Gene Symbol SCMH1
Protein Name Scm polycomb group protein homolog 1
Synonyms Scml3
Ortholog resource in our bank

  SCMH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081322 IRAL003F02 pOTB7 BC009752 NM_012236
HGY095613 IRAL039A13 pOTB7 BC021252 NM_001031694 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025762 W01A064G18 pENTR-TOPO IRAL003F02 BC009752 NM_012236  
HGE025764 W01A064G20 pENTR-TOPO IRAL003F02 BC009752 NM_012236  
HGE025768 W01A064G24 pENTR-TOPO IRAL003F02 BC009752 NM_012236  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070506 ARe76E10 pKA1U5 NM_012236.2  
GGCCCCCCGCGCGAGCCCAACNGCCGAGGCGCCCCNTANNTCGCAGCGGGAGGCGCGGGG
HKR452951 RBdS132G07 pGCAP10 NM_012236.2  
GCTCCGCTCCCTCCCTGCGCAGCGGAAACATGGCGGCGGGAAGGGAGTGAGCCGCCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl