Prev. | 

RIKEN DNA Bank Human Resource - SLC4A1AP

Gene ID NCBI Gene 22950 |  KEGG hsa:22950
Gene Symbol SLC4A1AP
Protein Name solute carrier family 4 member 1 adaptor protein
Synonyms HLC3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388954 RBd72G10 pGCAP10 NM_018158.2  
GATTTCGAAGTTGCACCGGTTGAGGATGGCTGACATTCTCTCTCAGTCAGAGACCCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl