Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PTGR1

Gene ID (NCBI) 22949
Gene Symbol PTGR1
Protein Name prostaglandin reductase 1
Synonyms LTB4DH|PGR1|ZADH3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13948)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX020988 IRAK052H20 pCMV-SPORT6 BC035228 NM_012212

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080814 M01C002A14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE080862 M01C002C14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE080910 M01C002E14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE080958 M01C002G14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE081006 M01C002I14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE081054 M01C002K14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE081102 M01C002M14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE081150 M01C002O14 pDONR221 04-134-2_1-F07 BC035228 ENST00000309195  
HGE088430 M01C021B06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088478 M01C021D06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088526 M01C021F06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088574 M01C021H06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088622 M01C021J06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088670 M01C021L06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088718 M01C021N06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE088766 M01C021P06 pDONR221 IMS03-D03 BC035228 ENST00000309195  
HGE093611 M01C034A11 pDONR221 MGC06-E06 BC035228 ENST00000309195  
HGE110840 M01C077B16 pDONR221 06-2_02-D08 BC035228 ENST00000309195  
HGE110888 M01C077D16 pDONR221 06-2_02-D08 BC035228 ENST00000309195  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173279 ARi33D07 pGCAP10 NM_012212.2  
GGCAGTCCCAGCCGCCTTCCCCAGGCAGTGGAACCTTCGGGCTCCTGAGCTTCAGGATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl