Prev. |  KEGG KO K09497 > 

RIKEN DNA Bank Human Resource - CCT5

Gene ID NCBI Gene 22948 |  KEGG hsa:22948
Gene Symbol CCT5
Protein Name chaperonin containing TCP1 subunit 5
Synonyms CCT-epsilon|CCTE|HEL-S-69|PNAS-102|TCP-1-epsilon
Ortholog resource in our bank

  CCT5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080847 IRAL002B23 pOTB7 BC006543 NM_012073 Full
HGY083268 IRAL008C20 pOTB7 BC002971 NM_012073 Partial
HGY089405 IRAL023I13 pOTB7 BC009454 NM_012073 Partial
HGY092060 IRAL030C12 pOTB7 BC035499 NM_012073 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099632 M01C049B08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099680 M01C049D08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099728 M01C049F08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099776 M01C049H08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099824 M01C049J08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099872 M01C049L08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099920 M01C049N08 pDONR221 MGC14-D04 BC006543 NM_012073  
HGE099968 M01C049P08 pDONR221 MGC14-D04 BC006543 NM_012073  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048169 ARe20H01 pKA1U5 NM_012073.3  
GGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACCATGGCGTCCATGGGGACCCTCGCC
HKR073353 ARe83G09 pKA1U5 NM_012073.3  
GATTCTCGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACC
HKR078829 ARe97B05 pKA1U5 NM_012073.3  
GGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACCATGGCG
HKR171605 ARi29A05 pGCAP10 NM_012073.3  
GATTCTCGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACC
HKR264760 ARiS161O24 pGCAP10 NM_012073.3  
TGGGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACCATGGCGTCCATGGGGACCCTCG
HKR339682 RBb49D10 pGCAP1 NM_012073.3  
GGGCTGNNGCACCATGGNCGNTCCATGGGGACCCTCGCCTNCCCTTNATAGGGGCGCCCT
HKR346545 RBb66G01 pGCAP1 NM_012073.3  
GCATTCTCGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCAC
HKR374973 RBd37H05 pGCAP10 NM_012073.3  
GGGCTGTTGCACCATGGCGTCCATGGGGACCCTCGCCTTCGATGAATATGGGCGCCCTTT
HKR403025 RBdS007J09 pGCAP10 NM_012073.3  
GGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACCATGGCG
HKR405280 RBdS013D08 pGCAP10 NM_012073.3  
CGGCCGGCCGATNANNNNTTCCGGCTGTTGCACCATGGCGTCCATGGGGACCCTCGCCTT
HKR405860 RBdS014K20 pGCAP10 NM_012073.3  
GATTCTCGCTTCCGTAGCGGTCTCCGCCGGTTGGGGGAAAGTAATTCCGGCTGTTGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl