DNA Bank Top |  KEGG KO K02165 > 

RIKEN DNA Bank Human Resource - DKK1

Gene ID NCBI Gene 22943 |  KEGG hsa:22943
Gene Symbol DKK1
Protein Name dickkopf WNT signaling pathway inhibitor 1
Synonyms DKK-1|SK
Featured content Wnt signaling pathway (human)

Link

Ortholog resource in our bank

  DKK1

External database

human DKK1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07341 pGL4-phDKK1 Promoter collection, Human DKK1 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083066 IRAL007L02 pOTB7 BC001539 NM_012242 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE030630 W01A076J14 pENTR-TOPO IRAL007L02 BC001539 NM_012242  
HGE030632 W01A076J16 pENTR-TOPO IRAL007L02 BC001539 NM_012242  
HGE030640 W01A076J24 pENTR-TOPO IRAL007L02 BC001539 NM_012242  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050131 ARe25F11 pKA1U5 NM_012242.2  
TGGCAGAGCTCTGTGCTCCCTGCAGTCAGGACTCTGGGACCGCAGGGGGCTCCCGGACCC
HKR175752 ARi39G08 pGCAP10 NM_012242.2  
GGGGCCCGCGGTATAAAGGCAGCCGCGGTGGCGGTGGCGGCGCAGAGCTCTGTGCTCCCT
HKR208020 ARiS020A20 pGCAP10 NM_012242.2  
GAGAGCTCTGTGCTCCCTGCAGTCAGGACTCTGGGACCGCAGGGGGCTCCCGGACCCTGA
HKR264735 ARiS161N23 pGCAP10 NM_012242.2  
GAGAGCTCTGTGCTCCCTGCAGTCAGGACTCTGGGACCGCAGGGGGCTCCCGGACCCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl